Skip to content

cellgeni/STARsolo

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

103 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

starsolo — unified CLI for STARsolo scRNA-seq processing

A single command-line tool that wraps STAR in STARsolo mode for uniform processing of scRNA-seq data across multiple platforms.

Supported platforms

Subcommand Platform Barcode type Chemistry auto-detection
10x 10x Genomics (v1 – v4, multiome) CB_UMI_Simple
smartseq Smart-seq / Smart-seq2 SmartSeq (plate-based, no UMIs)
dropseq Drop-seq CB_UMI_Simple (no whitelist)
rhapsody BD Rhapsody CB_UMI_Complex (3 segments)
indrops inDrops CB_UMI_Complex (2 segments + adapter)
strt STRT-seq CB_UMI_Simple (96-barcode list)
qc Aggregate QC stats across runs

Installation

Prerequisites

The following tools must be available in $PATH before running starsolo:

Tool Tested version Purpose
STAR 2.7.10a Alignment & quantification
samtools 1.15.1 BAM indexing
seqtk 1.3+ Read subsampling (10x chemistry detection)
pbzip2 1.1+ Compressing unmapped reads
BBMap 38.97 Adapter trimming (optional, via bbduk.sh)

Tip: The included Dockerfile builds all of the above into a single container image.

STAR must be compiled with make STAR CXXFLAGS_SIMD="-msse4.2" to support --clipAdapterType CellRanger4 (see STAR#1218).

Install starsolo CLI

git clone <this-repo> && cd STARsolo

# Default: symlinks into ~/.local/bin
./install.sh

# Or specify a directory:
./install.sh /usr/local/bin

# Verify
starsolo --version

The installer creates a single starsolo symlink. All library code is resolved relative to the repo, so you can git pull to update in-place.

Reference genome

Use a standard STAR genome index. Cell Ranger-filtered references are recommended for comparability with Cell Ranger output.

STAR --runThreadN 16 --runMode genomeGenerate --genomeDir STAR --genomeFastaFiles $FA --sjdbGTFfile $GTF

By default, starsolo resolves references via --species:

$STARSOLO_REF_BASE/<species>/2020A/index

Override with --ref /your/path/to/index on any subcommand, or change STARSOLO_REF_BASE in etc/defaults.conf.

Barcode whitelists

Download 10x barcode whitelists from Cell Ranger and place them in the whitelist directory (default: /nfs/cellgeni/STAR/whitelists, configurable via --whitelist-dir or STARSOLO_WL_DIR).

Usage

starsolo <platform> <args…> [options]

Global options

Flag Description Default
-s, --species <name> Species name (human, mouse, …) — resolves reference automatically
-r, --ref <path> Explicit STAR index path (overrides --species)
-w, --whitelist-dir <dir> Barcode whitelist directory from config
-c, --cpus <N> Number of threads 16
--bam Output coordinate-sorted BAM off
--no-bam Suppress BAM output (default)
-h, --help Show help (global or per-platform)
--version Print version
-- Pass all following arguments verbatim to STAR

Passing extra options to STAR

Any arguments after a -- sentinel are passed verbatim to the underlying STAR command, appended after the built-in flags. This works on every platform and lets you override defaults or set options the CLI doesn't expose:

starsolo 10x /data/fastqs SAMPLE1 --species human -- --outFilterScoreMin 20 --soloFeatures Gene GeneFull SJ

The -- must come last, after all starsolo options.

Overriding built-in flags. Passthrough arguments are appended after the flags the CLI sets. STAR uses the last occurrence of a repeated parameter, so a passthrough flag overrides the built-in value of the same name — e.g. -- --outFilterScoreMin 20 replaces the default --outFilterScoreMin 30. For multi-value parameters this is a full replacement, not a merge: -- --soloFeatures Gene GeneFull SJ replaces the built-in feature list entirely. (The parameter does appear twice on the resulting command line; this is expected and harmless.)

10x Genomics

Automatically detects chemistry (v1–v4, multiome), strand specificity, and paired-end mode.

starsolo 10x /data/fastqs SAMPLE1 --species human
starsolo 10x /data/fastqs SAMPLE1 --ref /path/to/index --bam

10x chemistry detection

The script subsamples 200,000 reads and matches barcodes against all known whitelists:

10x version Whitelist CB len UMI len Strand
3' v1 737K-april-2014_rc.txt 14 10 Forward
3' v2 737K-august-2016.txt 16 10 Forward
3' v3/v3.1 3M-february-2018.txt 16 12 Forward
3' v4 3M-3pgex-may-2023.txt 16 12 Forward
5' v1.1/v2 737K-august-2016.txt 16 10 Reverse
5' v3 737K-august-2016.txt 16 12 Reverse
5' v4 3M-5pgex-jan-2023.txt 16 12 Reverse
multiome 737K-arc-v1.txt 16 12 Forward

Paired-end processing

5' libraries with long R1 reads (>50 bp) are automatically processed in paired-end mode with --soloBarcodeMate 1 --clip5pNbases 39 0. 3' libraries are always single-end.

Smart-seq / Smart-seq2

Requires a manifest file — a tab-separated file with three columns: R1_path, R2_path, cell_name.

starsolo smartseq manifest.tsv --species mouse

Aliases: smart-seq, ss2

Drop-seq

12 bp cell barcode, 8 bp UMI, no whitelist.

starsolo dropseq /data/fastqs SAMPLE1 --species human

Alias: drop-seq

BD Rhapsody

3 barcode segments + 8 bp UMI. Requires Rhapsody_bc1/2/3.txt in the whitelist directory.

starsolo rhapsody /data/fastqs SAMPLE1 --species human

Aliases: bd-rhapsody, bd

inDrops

2 barcode segments + adapter + 6 bp UMI. Requires inDrops_Ambrose2_bc1/2.txt in the whitelist directory.

starsolo indrops /data/fastqs SAMPLE1 --species human
starsolo indrops /data/fastqs SAMPLE1 --species human --adapter GAGTGATTGCTTGTGACGCCAA

Default adapter: GAGTGATTGCTTGTGACGCCTT

STRT-seq

96-barcode whitelist, 8 bp cell barcode, 8 bp UMI. Requires 96_barcodes.list in the whitelist directory.

starsolo strt /data/fastqs SAMPLE1 --species human --strand Forward

Extra option: --strand <Forward|Reverse> (default: Forward)

Alias: strt-seq

QC aggregation

starsolo qc <dir1> [dir2 … dirN] [options]

Pass one or more STARsolo output directories as positional arguments:

starsolo qc sample1/ sample2/ sample3/
starsolo qc results/GSM* | column -t
starsolo qc sample1/ sample2/ --species human
starsolo qc sample1/ sample2/ --no-contamination-check

QC options

Flag Description Default
-s, --species <name> Override species label in output (e.g. human, mouse) guessed from genomeDir in Log.out
--no-contamination-check Skip cross-sample barcode overlap check off (check runs by default)
-h, --help Show help

Checks performed

  • Completion — warns if _STARtmp is still present (run did not finish)
  • Cross-contamination — compares filtered barcodes between every pair of samples; warns if overlap exceeds 20%
  • Low mapping — warns if GeneFull unique mapping rate is ≤ 20%

Output columns

Outputs a tab-separated table to stdout (pipe through column -t for aligned display):

Column Description
Sample Directory name
Rd_all Total reads
Rd_in_cells Reads in cells (GeneFull)
Frc_in_cells Fraction of reads in cells
UMI_in_cells UMIs in cells
Cells Estimated number of cells
Med_nFeature Median genes per cell
Good_BC Fraction of reads with valid barcodes
WL Detected whitelist (v1, v2, v3, v4-3p, v4-5p, arc)
Species Species label
Paired Single or Paired
Strand Strand specificity
all_u+m / all_u Genome mapping rate (unique+multi / unique)
exon_u+m / exon_u Exonic (Gene) mapping rate
full_u+m / full_u Full-gene (GeneFull) mapping rate

Configuration

Edit etc/defaults.conf to change default paths and parameters. All values can also be set as environment variables:

export STARSOLO_REF_BASE=/my/references
export STARSOLO_WL_DIR=/my/whitelists
export STARSOLO_CPUS=8
export STARSOLO_BAM_MODE=bam

CLI flags always take precedence over environment variables, which take precedence over config file defaults.

Helper scripts

Script Purpose
scripts/bbduk_trim.sh Adapter/polyA trimming via BBMap
scripts/bsub_submit.sh Submit any starsolo command as an LSF job

LSF submission

./scripts/bsub_submit.sh starsolo 10x /data/fastqs SAMPLE1 --species human

This submits with 16 CPUs / 64 GB RAM to the normal queue.

Resource requirements

Default: 16 CPUs, 64–128 GB RAM. Some datasets require 128 GB; if jobs fail with OOM errors, increase RAM in your job submission.

Docker

The included Dockerfile builds all required tools:

docker build -t starsolo .
docker run -v /data:/data starsolo starsolo 10x /data/fastqs SAMPLE1 --species human

Project structure

STARsolo/
├── bin/
│   └── starsolo              # CLI entrypoint (add to PATH)
├── lib/
│   ├── common.sh             # Shared functions (FASTQ discovery, compression, post-processing)
│   ├── platform_10x.sh       # 10x Genomics logic
│   ├── platform_smartseq.sh  # Smart-seq2 logic
│   ├── platform_dropseq.sh   # Drop-seq logic
│   ├── platform_rhapsody.sh  # BD Rhapsody logic
│   ├── platform_indrops.sh   # inDrops logic
│   ├── platform_strt.sh      # STRT-seq logic
│   └── qc.sh                 # QC aggregation logic
├── etc/
│   └── defaults.conf          # Default configuration
├── scripts/
│   ├── solo_qc.sh             # QC aggregation
│   ├── bbduk_trim.sh          # Adapter trimming helper
│   └── bsub_submit.sh         # LSF job submission helper
├── Dockerfile
├── install.sh
├── LICENSE
└── README.md

License

See LICENSE.

About

wrapper scripts for convenient STARsolo processing of 10X and other scRNA-seq

Resources

Stars

Watchers

Forks

Releases

Packages

Used by

Contributors

Languages