The backbone of 1st structure does not move when display multiple structures with applyForce = True option

[LeKhang97]

When I tried to display multiple structures with applyForce = True, for the 2nd structure, it doesn't have any problem. But for the first structure, the backbone does not move with the nucleotide chain, thus extracting the backbone from the nucleotide chain.

Here is my code:

<script type='text/javascript' src='htdocs/js/jquery.js'></script>
<script type='text/javascript' src='htdocs/js/d3.js'></script>
<script type='text/javascript' src='htdocs/js/fornac.js'></script>

<script type='text/javascript'>
    var container = new FornaContainer("#rna_ss1", {'applyForce': true});
    var options = {'structure': '((..((....)).(((....))).))',
                   'sequence':  'CGCUUCAUAUAAUCCUAAUGACCUAU'};
    container.addRNA(options.structure, options);

    var container = new FornaContainer("#rna_ss2", {'applyForce': true});
    var options = {'structure': '((..((....)).(((....))).))',
                   'sequence':  'CGCUUCAUAUAAUCCUAAUGACCUAU'};
    container.addRNA(options.structure, options);

I would be very appreciated if someone can help me for this problem.