Contains the software implementation for Braidz. Braidz is a partition function based method for predicting the psuedoknotted secondary structures of RNA sequences.
Braidz should work on most Linux or Mac machines.
Requirements: A compiler that supports C++17 standard (tested with g++ version 4.7.2 or higher) and CMake version 3.1 or greater.
CMake version 3.1 or greater must be installed in a way that Braidz can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:
cmake --version
If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.
Easiest way is to install homebrew and use that to install CMake.
To do so, run the following from a terminal to install homebrew:
/usr/bin/ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install)"
When that finishes, run the following from a terminal to install CMake.
brew install cmake
Run from a terminal
wget http://www.cmake.org/files/v3.8/cmake-3.8.2.tar.gz
tar xzf cmake-3.8.2.tar.gz
cd cmake-3.8.2
./configure
make
make install
- Download the repository and extract the files onto your system.
- From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build
If you are getting errors about your comiler not having C++11 features, you may need to specify a specific compiler, such as g++. If you want to do so you can instead run something like
cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build
Usage: Braidz [options] [input sequence]
Read input file from cmdline; predict minimum free energy and optimum structure using the time- and space-efficient MFE RNA folding algorithm.
-h, --help Print help and exit
-V, --version Print version and exit
-i, --input-file=STRING Give a path to an input file containing the sequence (and input structure if known)
-o, --output-file=STRING Give a path to an output file which will the sequence, and its structure and energy
-d, --dangles=INT Specify the dangle model to be used (default=`2')
-P, --paramFile=STRING Read energy parameters from paramfile, instead of using the default parameter set.
-s, --samples=INT Give the number of samples for the stochastic backtracking (default=`1000')
-f, --fatgraph=INT Give the number of fatgraphs outputted, along with their frequencies (default=`1')
-O, --print-samples Print the samples with their multiplicities (default=off)",
--noConv Do not convert DNA into RNA. This will use the Matthews 2004 parameters for DNA (default=off)
--noGU Turn off G-U and U-G (and G-T and T-G) base pairing (default=off)
--noPS Don't create a Postscript drawing of the base pair probabilities (default=off)
Remarks: The default parameter file is DP09. This can be changed via -P and specifying the parameter file you would like
assume you are in the Braidz directory
./build/src/Braidz CGCGAGGGGCGCGAGGGGCCCCCCCC
./build/src/Braidz -P "params/rna_Turner04.par" CGCGAGGGGCGCGAGGGGCCCCCCCC
./build/src/Braidz -s 100000 -P "params/rna_Turner04.par"
./build/src/Braidz -i Examples/Cases.fa
Braidz is copyrighted under GNU General Public Licence.
Although the authors have made every effort to ensure that Braidz correctly implements the underlying models and fullfills the functions described in the documentation, neither the authors nor the University of Alberta guarantee its correctness, fitness for a particular purpose, or future availability.
If you have any issues or feature requests, please contact Mateo Gray: mateo2@ualberta.ca