Lowercase adapter auto-detected

[schorlton-bugseq]

Thanks for the great tool! Running v1.3.3 from bioconda, I hit:

Detecting adapter sequence for read1...
  tcgaatgaattgaatgcaatcatcgaatggtctcgaatggaatcatcttctaatggaaag

the adapter <adapter_sequence> can only have bases in {A, T, C, G}, but the given sequence is: tcgaatgaattgaatgcaatcatcgaatggtctcgaatggaatcatcttctaatggaaag

Ignoring the fact that I think this is a false positive adapter sequence detection (it looks human), I think the issue is fastp not handling casing between adapter detection and sequence processing? Does fastp support lowercase sequences in FASTQs?

Thanks for your consideration!

[sfchen]

Hi, can you let me know when we use lower-case FASTQ? I never met such file before.